Posted in P3 SBI3C Biology

SBI3C DNA Cut and Paste (aka Genetic Engineering)



Plasmid (aka vector) coding strand sequence from 5′->3′:

TATCGATAAGAATTCGCTTCTGCAGTCGACGCCCGGGGTAAGCTTTCTAGAGCGGCCGCCACCGCGGTGGAGCTC

Paste the above sequence into the NEB Cutter, set it to “Circular”. Hit submit. Then do a custom digest with EcoRI, HindIII and SalI. Copy this map into your notes with cut site locations of each of these enzymes.

Insert (gene of interest) coding strand sequence form 5′->3′:

CAGGGAATTCTAATGTCAGAATGTTCCTTCATACTGCTGTTCATACTGCTGCTCTGCTGAAGCTTCCAGTCCCAATTTAGTCGACCAC

Paste the above sequence into the NEB Cutter, keep it “Linear”. Hit submit. Then do a custom digest with EcoRI, HindIII and SalI . Copy this map into your notes with cut site locations of each of these enzymes.

Use EcoRI and SalI to splice the insert into the plasmid.



Posted in P2 SBI4U Biology

SBI4U DNA Cut and Paste (aka Genetic Engineering)

Plasmid (aka vector) coding strand sequence from 5′->3′:

TATCGATAAGAATTCGCTTCTGCAGTCGACGCCCGGGGTAAGCTTTCTAGAGCGGCCGCCACCGCGGTGGAGCTC

Paste the above sequence into the NEB Cutter, set it to “Circular”. Hit submit. Then do a custom digest with EcoRI, HindIII and SalI. Copy this map into your notes with cut site locations of each of these enzymes.

Insert (gene of interest) coding strand sequence form 5′->3′:

CAGGGAATTCTAATGTCAGAATGTTCCTTCATACTGCTGTTCATACTGCTGCTCTGCTGAAGCTTCCAGTCCCAATTTAGTCGACCAC

Paste the above sequence into the NEB Cutter, keep it “Linear”. Hit submit. Then do a custom digest with EcoRI, HindIII and SalI . Copy this map into your notes with cut site locations of each of these enzymes.

Use EcoRI and SalI to splice the insert into the plasmid.

Posted in P3 SBI3C Biology

SBI3C Restriction Enzymes

Enzyme Finder

NEB Cutter

In our study of gel electrophoresis, we see a series of digestions of lambda phage DNA with various enzymes. Bacteriophage, or phage for short, are viruses that infect bacteria and in most cases carry out a lytic cycle of replication as shown below. Lambda phage are just one strain. There are others like T4 phage.

Lambda Phage DNA ID number: J02459.1