Posted in P2 SBI4U Biology

SBI4U DNA Cut and Paste (aka Genetic Engineering)

Plasmid (aka vector) coding strand sequence from 5′->3′:

TATCGATAAGAATTCGCTTCTGCAGTCGACGCCCGGGGTAAGCTTTCTAGAGCGGCCGCCACCGCGGTGGAGCTC

Paste the above sequence into the NEB Cutter, set it to “Circular”. Hit submit. Then do a custom digest with EcoRI, HindIII and SalI. Copy this map into your notes with cut site locations of each of these enzymes.

Insert (gene of interest) coding strand sequence form 5′->3′:

CAGGGAATTCTAATGTCAGAATGTTCCTTCATACTGCTGTTCATACTGCTGCTCTGCTGAAGCTTCCAGTCCCAATTTAGTCGACCAC

Paste the above sequence into the NEB Cutter, keep it “Linear”. Hit submit. Then do a custom digest with EcoRI, HindIII and SalI . Copy this map into your notes with cut site locations of each of these enzymes.

Use EcoRI and SalI to splice the insert into the plasmid.

Posted in P2 SBI4U Biology

SBI4U Enzyme Finder and NEB Cutter

Enzyme Finder

NEB Cutter

In our study of gel electrophoresis, we see a series of digestions of lambda phage DNA with various enzymes. Bacteriophage, or phage for short, are viruses that infect bacteria and in most cases carry out a lytic cycle of replication as shown below. Lambda phage are just one strain. There are others like T4 phage.

Bacteria synthesize restriction endonucleases (REs) to scan and cut viral DNA shortly after it gets injected into the cell. They are a first line of defence and bacteria can make more than one RE. If the virus DNA is cut up immediately then bacteria can survive attacks from phage. Interestingly, if a cut site is found in the bacteria’s own DNA, methyl groups are added so that the bacteria’s REs won’t digest its own DNA.

Use the Enzyme Finder and NEB cutter to find recognition sites for each enzyme and determine if it leaves 5′ sticky ends, 3′ sticky ends or blunt end cuts of the phage DNA.

Also use these tools to find the fragments these enzymes generate and then draw the gel that corresponds to these digestions.

Lambda Phage DNA ID number: J02459.1

Posted in P2 SBI4U Biology

SBI4U Gel Electrophoresis

Gel Electrophoresis Handout

Answer the from the handout above in your notes.

For question 10, instead of answering questions a) & b) in the handout answer the following:

Assuming each band in the marker lane (lane 1) is a DNA fragment that is 100bp bigger than than the next and the smallest one is 100bp,

a) How big are the fragments in the EcoRI lane?

b) How big are the fragments in the BamHI lane?

c) How big are the fragments in the EcoRI/BamHI lane?

d) Do you think the original DNA that was cut in each lane (EcoRI, BamHI, EcoRI/BamHI) came from the same source or a different source?  Justify your answer.

You can watch this video as well for help with the above question

Posted in P2 SBI4U Biology

SBI4U PCR

In a happy accident in the history of science, Dr. Kary Mullis accidentally discovered the polymerase chain reaction when he was trying to develop a method to produce more oligonucleotides (DNA primers) to be used in research.  You can read about it here if you are interested.  He won a little prize for his discovery.

pcrlab